1.5M ratings
277k ratings

See, that’s what the app is perfect for.

Sounds perfect Wahhhh, I don’t wanna

jesus i heard things on twitter but this is my first time logging in since before the 17th… i Hate it. i Rely on icons to know who’s who?? they’re gone
it wont make the rb icon turn green if anything involved is flagged and that’s Concerning
im not taking extra steps to view things if they’re Hidden
crawling back to twitter immediately cause i cant deal with this effectively

snowradish
andrea-dworkin

“A long-term study of children raised by lesbians found that these children were less likely to suffer from physical and sexual abuse than were their peers who were raised by heterosexuals. This is thought to be due to the absence of adult heterosexual men in the households (Gartrell, Bos, & Goldberg, 2010). Girls raised by lesbians tend to have higher self-esteem, show more maturity and tolerance than their peers, and are older when they have their first heterosexual contact (Gartrell et al., 2005, 2010). Children raised by same-sex parents seem to be less constrained by traditional gender roles; boys are less aggressive, and girls are more inclined to consider nontraditional careers, such as doctor, lawyer, or engineer (Gartrell et al., 2005; Stacey & Biblarz, 2001). Over the course of more than 20 years, scientists studied the psychological adjustment of 78 teenagers who were raised by lesbian mothers. Compared to age-matched counterparts raised by heterosexual parents, these adolescents were rated higher in social, academic, and total competence, and lower in social problems, rule-breaking, aggression, and externalizing problem behavior (Gartrell & Bos, 2010). There are fewer studies of children raised by two men, but gay fathers are more likely than straight fathers to put their children before their career, to make big changes in their lives to accommodate a child, and to strengthen bonds with their extended families after becoming fathers (Bergman, Rubio, Green, & Padrone, 2010).”
~ Martha Rosenthal, Human Sexuality: From Cells to Society, p.247.

instantgalaxy-justaddstars

“having gay parents will harm children”

kanguin

I love that this is cited and sourced ahhhh. Actual researched support! So good.

tiyadyree

Here’s Gartrell, Bos, and Goldberg’s paper since whatever link that was is broken.

Source: spinsterhoods-archive
bitbats
personalpersonel:
“ thats-so-meme:
“ dbdspirit:
“ In response to the NSFW ban being enacted by Tumblr Staff, on December 17th 2018 I propose that we all log off of our Tumblr accounts for 24 hours.  The lack of respect and communication between staff...
dbdspirit

In response to the NSFW ban being enacted by Tumblr Staff, on December 17th 2018 I propose that we all log off of our Tumblr accounts for 24 hours. 


The lack of respect and communication between staff and users is stark. Users have been begging staff to delete the porn bot outbreak, which has plagued the website for well over a year. The porn bots oftentimes send people asks and messages, trying to get them to go to a website full of viruses. They also spam advertisements on others posts.  

Users have also begged that Tumblr ban neo-nazis, child porn, and pedophiles, all which run rampant on the site. The site/app got so bad that it was taken off the app store.

However, instead of answering the users, Tumblr has instead taken the liberty to ban all NSFW content, regardless of age. But users have already run into issues of their SFW content being marked as sensitive and being flagged as NSFW, not allowing them to share their work.

Not only does this discriminate again content creators, but it also discriminates against sex workers. Disgustingly, the ban will be enacted on December 17 which is also International Day to End Violence Against Sex Workers.

This ban is disgusting, and while I (and plenty of others) welcome porn bots and child porn being banned, the Tumblr filtration system is broken. It tags artistic work’s nipples as NSFW (when it is art), it tags SFW art as NSFW (when it is not), and does not stop the porn bots, neo-nazis and dozens of other issues.


This ban is discriminatory. This ban is ineffective. This ban is unacceptable. 


To protest, log off of your Tumblr account for the entirety of December 17th. Log off at 12 am EST or 9PM PST and stay off for 24 hours. Don’t post. Don’t log on. Don’t even visit the website. Don’t give them that sweet ad revenue. 

Tumblr’s stock has already taken a hard hit. Let’s make it tank. Maybe then they will listen to the users. 


Reblog to signal boost! We must force change.

thats-so-meme

Let’s make it happen.

No activity for 24h in our timezone on 17 December 2018.

personalpersonel

Don’t forget to logout on all devices.

Source: dbdspirit
snowradish
thisisthinprivilege

I work at a daycare with infants.

One of our baby girls is fat, in the 99th percentile for her age. She is super cute and sweet. Lately, she has been sick with various breathing issues, so she has been reluctant to take her bottles. Normally, she’ll take 4 ounces of formula at lunch and 8 ounces in the afternoon. Today, I was lucky to get to her take 5 all day.

There was a substitute covering a lunch break in my classroom today. We emphasized to her that we need to keep trying to get the baby to drink her bottle until she finished it. She said, “Why are you guys so worried about taking her bottle?”

My coworker replied, “That’s where all her nutrients are. She needs the nutrients and the water.”

To which the substitute replied, “But she’s so fat. She doesn’t need it.”

Thin privilege is a small, pretty baby getting better childcare because the caretaker doesn’t think she’s too fat to be allowed to eat.

thecrazygeek-rant

This reminds me of a cousin of mine who ended up with her kids being taken away from her by social services for a number of reasons but mostly for nearly killing her baby daughter. How?

By starving her. She insisted that her baby was ‘too fat’ and had an aim to remove any and all ‘chubbyness’ so her baby would be thin. She’d already been warned by her doctor about the baby not getting enough food, but insisted she knew best.

After several months of this her baby passed out cold one day and was rushed into hospital where the doctors found her to have severe malnutrition, a low body temperature and low pulse rate. They asked my cousin what she’d been feeding her daughter and she said “one bottle of skimmed milk a day. I don’t want her growing up fat.”

Even after nearly killing her daughter my cousin maintained her view that fat = bad and ended up with all her kids taken from her because she was starving them and neglecting them.

When your fatphobia leads you to starving your own children then you’ve got serious problems.

(Note. She still, to this day, maintains the view that she was right and the doctors were wrong. “They just want fat kids so they can keep employed treating them for all those diseases that being fat causes.” = her actual words.)

sinthiasweet

My mom had me dieting with her when I was eleven. She had me eating less than 600 calories a day because she was worried I was going to “get huge.” She even grounded me once because she found out my friends were bringing me lunches! I ended up passing out, going to the ER, and getting two IVs at once BC I was so goddamn dehydrated. Soooooo surprised they didn’t call child services… And looking back, this was the root of my anorexia. I’m nearly 22 and still fighting it. Please don’t starve your fucking children.

viergacht

For fucks sake babies are SUPPOSED to be fat, what is wrong with people? It’s just stored energy, and growing children need stored energy - an 11 year old is just about to hit some major growing years. Damn. 

fattyatomicmutant

Fatphobia

Is

Real

and it kills

tribvtaries

This is no joke. people will literally starve their own babies cause they don’t want them getting fat. A parent brought in their six month old baby who was having breathing issues and kept getting sick. the parent was asked if the baby was eating regularly and the parent straight up told the doctor that they only feed the baby once a day. ONCE A DAY. A FUCKING BABY. they even had the nerve to say because they didn’t want the baby to get fat. people like this are real. they would rather have a dead baby than a fat one.

bigfatscience

My youngest son is a very big boy and has been since he was born. When he was 10 months old I took him for his well-baby check and vaccinations. The nurse noted his weight and said, quite casually, “He is in the 99th percentile for weight so he is at risk for obesity. You may want to keep an eye on that.” I said, “He is exclusively breastfed. He refuses to eat any solids yet.” What did she expect me to do? What would it mean to “keep an eye on” an exclusively breastfed baby’s weight? 

She backed off saying, ‘Well he looks fine!” – proving once again that weight bias is not truly about health – But I know many other parents who are not as informed as I am about weight science and size diversity would react to this interaction by policing their child’s food intake, if not as an infant, then when he was an older child. This is exactly the type of seemingly-inconsequential interaction that starts the ball rolling on a lifetime of dieting, disordered eating, negative body image, and weight-based abuse for too many fat people.

Years later when he was five, another doctor measured his weight and height and commented that he is off the charts on both, but “at least he is in proportion.” And if he was not “in proportion,” I am sure I would have been advised once again to “watch his weight.” 

I no longer allow healthcare providers to weight my children unless it is absolutely medically necessary. They are unable to control their weight talk, which is a known harm for children.

We need to completely eliminate weight talk from medicine, especially when it comes to children. Even the smallest exposure can have terrible consequences.

loverofbrownsugar

Wtf…

mainstreamqueen

A friend from college had been going to the doctor because she was having trouble breathing. She was told to lose weight. Over the course of several years, she went back to the doctors time and time again, telling them that she’d been sticking to the diet but because of her breathing problems she had been unable to even walk for more than 20 minutes at a time. The doctor got her into an exercise programme and told her that she just needed to really try to lose weight because that was clearly the reason for her breathing problems. By the time they found the tumour on her lungs, it was inoperable. She only lived three months after diagnosis. She was 25. She’d had the tumour for over five years. The doctor was so focused on the fact that my friend was “fat”, that they refused to look for any underlying cause. They killed her.

thisisthinprivilege

Weight-first treatment KILLS. Fatphobia KILLS.

lady-yomi

I have 2 scary stories to share about fatphobic doctors & parents harming their childs/patients’ health:

1. The 4 years old daughter of a friend of mine came to our house to spend the weekend. She gave me a letter from her mom that said that the child was in a glutenfree diet because she was getting ‘awfully fat’ when eating cookies or bread (my celiac ass; who gets dhiarrea and loses a scary amount of weight whenever I eat something with gluten was like ’???’).

You can bet that I went to the supermarket with the kid and told her ‘go & take whatever you feel like eating’ and the poor child came back smiling with her arms full of biscuits and cupcakes.

She didn’t got sick (as a celiac would get) and told me later that she hated the diet her mother made her follow; because her cousins didn’t had to pass through that.

And what’s the scariest thing about this story? Her mother was a NURSE. A fucking nurse who didn’t have a clue of the harm that she was doing to her daughter’s body!

2. My little sister started to feel fatigued and dizzy at 9 years old. She felt nauseated at the sight of food and had abdominal pain that increased with physical activity.

Mom got her to the ER and the doctor dismissed it saying: ‘she’s fat and probably is feeling ill after eating too much burgers, get her to make some exercise and she will be better in no time’.My mom didn’t felt ok with the diagnosis and took my sister with a second doctor who also told her that ‘the child was just fat’.

My sister’s skin was starting to get yellow as the days passed and the abdominal pain was getting awful so my mom (heaven bless her!) got her to the ER for the third time:

SHE HAD STAGE 4 HEPATITIS AND WAS ABOUT TO DIE.

She survived after a long and painful recovery who involved being in bed for a whole year (remember that we’re speaking of a 9 years old child). Luckily they saved her liver and she didn’t went through a transplant… but let this sink:

If it weren’t for my mother, fatphobia would have killed her. Fatphobia kills kids and teenagers, fatphobia kills inocent people everyday. It treats human beings as lesser than others and hurts them in their most vulnerable times.

It’s a real shame that we all have so much stories to share about this issue. A REAL SHAME.

agreekdoctor

Future doctors, interns, and residents following me:

FUCKING TAKE NOTE OF THIS!

Don’t let bias against your fat patients kill them!

clatterbane

(#and this is just when we actually go to the doctor and tell them we have problems #how many of us just give up #or won’t mention anything that seems like too much of a ‘fat’ problem)

thelittlestastronaut

i’d really like my thin followers to reblog this if you can. fat people are already here for each other, we need you guys to help us out too. this is something i never see anyone actually talking about in-depth, and it’s disappointing. be there for your fat siblings, too.

Source: thisisthinprivilege
notjayyy
askphilososhy

Approaching zero hour and we can’t see any of @warriormale on our dashboard nor can we reblog or like any of his posts anymore when we could just yesterday… upon attempting to @ him we found that it does NOT recognize him anymore… we think it’s safe to say he’s PROBABLY being suppressed… for NOTHING other than speaking out against tumblr and trying to help create a safe community… They’ve been fucking with his account since a day after they announced this new bullshit.

BUT WE WILL NOT BE SILENCED!!!

COME JOIN THE WARRIORMALE DISCORD! WE HAVE JUST BECOME AN ADMIN THERE AND IT IS A SAFE PLACE AND WE WILL ENDEAVOR TO KEEP IT THAT WAY! THERE ARE MANY GOOD PEOPLE THERE AND A BIG COMMUNITY AND WE WILL NOT LET IT DIE!


Abandon this sinking ship!

STAND STRONG!
STAND TOGETHER!

Source: askphilososhy ;_;7 mr. warriormale it's been an honor
hineway
mxxn-kitten

Me- I don’t wanna go to class today. I feel out of it

*classes is cancelled *

Me- God???? Is that you???

stonedlilbrat

Me: I️ don’t want to go to work today

Boss:

image

(Looks like God’s got both our backs today)

mxxn-kitten

Bless this day ❤️❤️❤️

vampire-kohai

I swear this post is blessed or something because I said “I want a reason to go somewhere” while looking at this post and then pretty much just after, my mother asked me to go to the store to get some eggs since I used the last 2

mxxn-kitten

Reblog this post to get something you want

cr-mango
intranet

Incase anything happens to my account here’s my entire genome:

GATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGYTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTAOCGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHUATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTCKAATCAATCCTCHATCTNACCCCCTTTAFCOGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTAFCGATCCCGTAGWGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTGATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGIAGGGTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGHCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTACGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCACGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTDCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATOCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCHATCTACCCCCTTTAFCGATCCCGDTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCATCTACCCCCTTTAFOCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCCTTTAFCGATCCCGTAGGGTIAGGATCCTCATCTACCTCTTCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAOATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCETCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTMTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGG…

monkeysky

You got like six unique nucleotides so nice

deepspacepirate

image
image

OP is a virus from outer space

deepspacepirate

image
image

FUCK YOU OP

Source: anneuaidd